S. A. Cutler

Departamentul de științe animale, Universitatea de stat din Iowa, Ames, Iowa, 1 Microbiologie veterinară și medicină preventivă, Universitatea de stat din Iowa, Ames, Iowa, 2 Departamentul de știință a animalelor, Universitatea de stat din Carolina de Nord, Raleigh, Carolina de Nord 3

prevenirea

S. M. Lonergan

Departamentul de științe animale, Universitatea de stat din Iowa, Ames, Iowa, 1 Microbiologie veterinară și medicină preventivă, Universitatea de stat din Iowa, Ames, Iowa, 2 Departamentul de știință a animalelor, Universitatea de stat din Carolina de Nord, Raleigh, Carolina de Nord 3

N. Cornick

Departamentul de științe animale, Universitatea de stat din Iowa, Ames, Iowa, 1 Microbiologie veterinară și medicină preventivă, Universitatea de stat din Iowa, Ames, Iowa, 2 Departamentul de știință a animalelor, Universitatea de stat din Carolina de Nord, Raleigh, Carolina de Nord 3

A. K. Johnson

Departamentul de științe animale, Universitatea de stat din Iowa, Ames, Iowa, 1 Microbiologie veterinară și medicină preventivă, Universitatea de stat din Iowa, Ames, Iowa, 2 Departamentul de știință a animalelor, Universitatea de stat din Carolina de Nord, Raleigh, Carolina de Nord 3

C. H. Stahl

Departamentul de științe animale, Universitatea de stat din Iowa, Ames, Iowa, 1 Microbiologie veterinară și medicină preventivă, Universitatea de stat din Iowa, Ames, Iowa, 2 Departamentul de știință a animalelor, Universitatea de stat din Carolina de Nord, Raleigh, Carolina de Nord 3

Abstract

Cu îngrijorare la nivel mondial cu privire la utilizarea antibioticelor profilactice în agricultura animală și contribuția acesteia la răspândirea rezistenței la antibiotice (12, 34, 38), dezvoltarea de alternative la antibioticele convenționale este urgent necesară pentru a proteja porcii de aceste infecții cu E. coli. Preocupările publice legate de rezistența la antibiotice au dus la eliminarea utilizării profilactice a antibioticelor în agricultura animală în Danemarca (20, 34). Această încetare a utilizării antibioticelor profilactice în producția de porc a cauzat creșteri ale ratei PWD și o creștere cu 30% a mortalității purceilor (34). Aceste infecții au dus la o creștere semnificativă a utilizării antibioticelor prescrise de medicul veterinar în industria porcină din Danemarca (35). Trecerea de la utilizarea antibioticelor care promovează creșterea sau utilizarea profilactică a antibioticelor la utilizarea terapeutică prescrisă de medicul veterinar a dus la o reducere foarte modestă, dacă există, a utilizării totale a antibioticelor în industria porcină din Danemarca (35). Pentru a realiza o reducere reală a utilizării antibioticelor în agricultura animală, trebuie dezvoltate terapii alternative eficiente.

O alternativă potențială la antibioticele convenționale care deține o mare promisiune sunt colicinele. Colicinele sunt o clasă de bacteriocine produse și eficiente împotriva E. coli și a bacteriilor înrudite (14). Colicinele care formează pori, cum ar fi colicina E1, se leagă de bacteriile țintă și le ucid prin perturbarea gradientului ionic al celulei (14). Aceste proteine ​​sunt deosebit de atractive pentru utilizare ca alternativă la antibioticele convenționale pentru controlul PWD cauzat de E. coli din mai multe motive. Le-am arătat anterior că sunt eficiente împotriva tulpinilor ETEC izolate de porci cu PWD in vitro (33), iar alte lucrări au demonstrat că colicina E1 este eficientă împotriva unei game largi de tulpini de E. coli (22, 27, 30). De asemenea, acestea nu sunt legate de niciun antibiotic care este utilizat în prezent în medicina umană. În plus, colicinele nu ar fi absorbite intacte de animale, eliminând astfel îngrijorările legate de prezența reziduurilor de antibiotice în carne, iar colicinele ar putea fi eficiente la concentrații scăzute suficient pentru a nu modifica semnificativ densitatea nutrienților din dietă. Obiectivul acestui studiu a fost de a determina eficacitatea includerii dietetice a colicinei E1 în prevenirea PWD datorită ETEC F18-pozitiv.

MATERIALE ȘI METODE

Producția de colicină.

Colicina E1 a fost produsă și purificată până la omogenitate prin metoda lui Stahl și colab. (33). Pe scurt, o tulpină de E. coli producătoare de colicină E1 a fost cultivată în mediu LB, iar producția de colicină a fost indusă prin adăugarea de mitomicină C (EMD Biosciences, San Diego, CA) la mediu. Colicina E1 a fost purificată din supernatantul fără celule prin cromatografie cu schimb de ioni, mai întâi utilizând celuloză DEAE (Sigma-Aldrich, St. Louis, MO) și apoi prin purificarea suplimentară a proteinei cu Q Sepharose (GE Healthcare, Piscataway, NJ ). Puritatea colicinei E1 utilizată în acest studiu a fost vizualizată prin electroforeză pe gel de dodecilsulfat de sodiu-poliacrilamidă și se estimează a fi peste 95% pură (30).

Tulpini de provocare ETEC.

Ca tulpini provocatoare s-au folosit tulpini 2144 (O147: NM, producătoare de Escherichia coli F18) și S1191 (O139) care produc F18. Tulpina S1191 a fost izolată de la un porc cu boală de edem, produce toxine stabile la căldură (ST) STa și STb și toxina Shiga 2e și este rezistentă la cloramfenicol. Tulpina 2144 a fost un izolat de câmp care a fost rezistent la acidul nalidixic și produce toxinele STa și STb. Ambele tulpini au fost crescute peste noapte ca culturi pure în mediu LB la 37 ° C cu agitare. Au fost apoi diluați individual la o densitate optică la 600 nm (OD600) de 0,1 în mediu LB proaspăt și au fost lăsați să crească până la un OD600 de ≈1. Culturile au fost apoi centrifugate la 4.000 × g timp de 10 minute la 4 ° C. Peletele bacteriene au fost resuspendate în 20% dextroză și 5% lapte uscat fără grăsime. Doza de provocare a constat într-o cantitate egală din fiecare tulpină și a fost determinată prin diluare în serie și placare pentru a furniza o doză totală de 2 × 10 9 CFU/0,5 ml doză orală.

Animale.

Toate protocoalele noastre care implică animale au fost aprobate de Comitetul instituțional de îngrijire și utilizare a animalelor de la Universitatea de stat din Iowa. Cele 24 de vagoane (porci castrați) utilizate au fost obținute de la ferma de nutriție a porcinelor din Universitatea de Stat din Iowa și s-au stabilit că sunt susceptibile la infecții cu E. coli F18 pozitive pe baza testului de polimorfism de lungime a fragmentului de restricție descris de Frydendahl și colab. (15). Pe scurt, ADN-ul genomic a fost purificat (kit DNeasy; QIAGEN, Valencia, CA) din tăieturile cozii de porc și primerii (primerul înainte, TTGGGAACCAGATGGGACAGTATG; primerul invers, CCCGCCAAGGAGCGTGCCTGTCTA) au fost folosiți pentru a amplifica o secțiune de 162-bpse a genei enzimei (ECF18) PCR (26). Produsul PCR de 162 bp a fost apoi digerat cu HhaI (New England Biolabs, Ipswich, MD), iar polimorfismul a fost determinat prin comparație de mărime pe un gel de agaroză de 3%.

Porcii au fost înțărcați la vârsta de 17 zile și li s-a permis să se adapteze la hrana solidă (TechStart 17-25; Kent Feeds, Muscatine, IA). La vârsta de 21 de zile, porcii (n = 8) au fost repartizați în grupuri de tratament pe baza greutății corpului lor și au fost transferați în țarcuri individuale. Porcilor li s-au administrat 2 zile pentru a se adapta la adăposturile individuale înainte ca dietele experimentale să fie hrănite. Dieta bazală pentru toate dietele experimentale a fost pe bază de porumb și soia și nu conținea produse de origine animală (26% proteine ​​brute, 3,51 kcal/kg de dietă). Această dietă a îndeplinit sau a depășit cerințele nutritive ale acestor porci, pe baza recomandărilor din 1998 ale Consiliului Național de Cercetare (29). Fie 0 (martor), 11 sau 16,5 mg de colicină E1 purificată (furnizat la 10 mg/ml în 10 mM Tris, pH 7,6) s-au adăugat pe kg la dieta bazală (TestDiet; Purina, Richmond, IN) și dietele au fost apoi peletizate la temperatură scăzută. Rațiile peletate au fost furnizate porcilor de două ori pe zi, la o rată care a depășit consumul pentru fiecare animal (aproximativ 500 g/zi). Furajele neconsumate au fost cântărite zilnic și s-a determinat aportul de furaje.

După ce animalele au primit dietele experimentale timp de 2 zile, toate animalele au fost inoculate pe cale orală cu cele două tulpini ETEC F18 pozitive și s-au înregistrat scorurile lor fecale. Scoruri fecale (0, fecale uscate, dure și bine formate; 1, fecale moi, dar formate; 2, fecale pastoase de culoare verde sau maro; 3, fecale vâscoase de culoare deschisă, episodice; 4, fecale fluide de culoare deschisă, episodic; 5, fecale apoase, continue) au fost determinate de două ori pe zi după provocarea bacteriană. Probele fecale au fost obținute cu 2 zile înainte de provocarea ETEC și zilnic după provocare prin inserarea unei bucle fecale de 10 μl (Fisher Scientific, Pittsburgh, PA) în rect. Aceste probe au fost imediat diluate în 5 ml de soluție salină sterilă tamponată cu fosfat. Diluții seriale de 10 ori (până la 1: 100.000) au fost placate pe plăci de agar de acid agar MacConkey (MAC; Difco, Franklin Lakes, NJ), MAC-cloramfenicol și MAC-nalidixic pentru determinarea CFU. Limita noastră de detectare pentru probele fecale a fost de 10.000 CFU/g. Patru zile după provocare, toți porcii au fost eutanasiați cu șurub captiv și s-au colectat probe de țesut. Secțiuni ileale (aproximativ 10 cm fiecare) au fost colectate de la fiecare porc pentru extracția ARN și enumerarea E. coli. În plus, conținutul rectal și cecal au fost colectate pentru enumerarea E. coli.

Expresia genelor.

TABELUL 1.

Exemple de secvențe pentru analiza semicantitativă în timp real PCR a expresiei genei intestinale

  •